The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
Epigenetic regulation in the rumen,a unique ruminant organ,remains largely unexplored compared with other tissues studied in model species.In this study,we perform an in-depth analysis of the epigenetic and transcript...Epigenetic regulation in the rumen,a unique ruminant organ,remains largely unexplored compared with other tissues studied in model species.In this study,we perform an in-depth analysis of the epigenetic and transcriptional landscapes across fetal and adult bovine tissues as well as pluripotent stem cells.Among the extensive methylation differences across various stages and tissues,we identify tissue-specific differentially methylated regions(tsDMRs)unique to the rumen,which are crucial for regulating epithelial development and energy metabolism.These tsDMRs cluster within super-enhancer regions that overlap with transcription factor(TF)binding sites.Regression models indicate that DNA methylation,along with H3K27me3 and H3K27ac,can be used to predict enhancer activity.Key upstream TFs,including SOX2,FOSL1/2,and SMAD2/3,primarily maintain an inhibitory state through bivalent modifications during fetal development.Downstream functional genes are maintained mainly in a stable repressive state via DNA methylation until differentiation is complete.Our study underscores the critical role of tsDMRs in regulating distal components of rumen morphology and function,providing key insights into the epigenetic regulatory mechanisms that may influence bovine production traits.展开更多
Carotenoids, which generate yellow, orange, and red colors, are crucial pigments in avian plumage. Investigations into genes associated with carotenoid- based coloration in avian species are important; however, such r...Carotenoids, which generate yellow, orange, and red colors, are crucial pigments in avian plumage. Investigations into genes associated with carotenoid- based coloration in avian species are important; however, such research is difficult because carotenoids cannot be synthetized in vertebrates as they are only derived from dietary sources. Here, the golden pheasant （Chrysolophus pictus） was used as a model in analysis of candidate gene expression profiles implicated in carotenoid binding and deposition. Using mass and Raman spectrometry to confirm the presence of carotenoids in golden pheasant feathers, we found C40H540 and C40H5602 in feathers with yellow to red colors, and in the rachis of iridescent feathers. The global gene expression profiles in golden pheasant skins were analyzed by RNA-seq and all six carotenoid binding candidate genes sequenced were studied by real- time PCR. STAR4, GSTA2, Scarbl, and APOD in feather follicles showed different expressions in red breast and orange nape feathers compared with that of iridescent mantle feathers. Further comparison of golden pheasant yellow rump and Lady Amherst＇s pheasant （Chrysolophus amherstiae） white nape feathers suggested that GSTA2 and APOD played a potential role in carotenoid-based coloration in golden pheasant.展开更多
This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat（CRISPR）/Cas9-mediated gene knock-ins with zinc finger nucleases（ZFNs） and transcription activator-like effe...This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat（CRISPR）/Cas9-mediated gene knock-ins with zinc finger nucleases（ZFNs） and transcription activator-like effector nucleases（TALENs） in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin（MSTN） gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in theGFP-PGK-Neo R plasmid background, including a 5′ and 3′ homologous arm flanking the genes humanized Fat-1（h Fat-1） or enhanced green fluorescent protein（eGFP）. Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and thehFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418（Geneticin） selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP andhFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP andhFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, thehFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knockin efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant（P〈0.01）. In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP andhFat-1 gene knock-ins were 32.35 and 26.47%, respectively. Theefficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant（P〈0.01）. This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.展开更多
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金funded by the Science and Technology Major Project of the Inner Mongolia Autonomous Region of China to the State Key Laboratory of Reproductive Regulation(2023KYPT0010 and 2021ZD0048)STI 2030-Major Projects(2023ZD0407504)of China+1 种基金the development plan for young scientific and technological talents in colleges and universities of Inner Mongolia Autonomous Region of China(NMGIRT2204)the National Natural Science Foundation of China(32160172).
文摘Epigenetic regulation in the rumen,a unique ruminant organ,remains largely unexplored compared with other tissues studied in model species.In this study,we perform an in-depth analysis of the epigenetic and transcriptional landscapes across fetal and adult bovine tissues as well as pluripotent stem cells.Among the extensive methylation differences across various stages and tissues,we identify tissue-specific differentially methylated regions(tsDMRs)unique to the rumen,which are crucial for regulating epithelial development and energy metabolism.These tsDMRs cluster within super-enhancer regions that overlap with transcription factor(TF)binding sites.Regression models indicate that DNA methylation,along with H3K27me3 and H3K27ac,can be used to predict enhancer activity.Key upstream TFs,including SOX2,FOSL1/2,and SMAD2/3,primarily maintain an inhibitory state through bivalent modifications during fetal development.Downstream functional genes are maintained mainly in a stable repressive state via DNA methylation until differentiation is complete.Our study underscores the critical role of tsDMRs in regulating distal components of rumen morphology and function,providing key insights into the epigenetic regulatory mechanisms that may influence bovine production traits.
基金supported by the 2014 Fundamental Research Program from Science and Technology of the Inner Mongolia Autonomous Region of China
文摘Carotenoids, which generate yellow, orange, and red colors, are crucial pigments in avian plumage. Investigations into genes associated with carotenoid- based coloration in avian species are important; however, such research is difficult because carotenoids cannot be synthetized in vertebrates as they are only derived from dietary sources. Here, the golden pheasant （Chrysolophus pictus） was used as a model in analysis of candidate gene expression profiles implicated in carotenoid binding and deposition. Using mass and Raman spectrometry to confirm the presence of carotenoids in golden pheasant feathers, we found C40H540 and C40H5602 in feathers with yellow to red colors, and in the rachis of iridescent feathers. The global gene expression profiles in golden pheasant skins were analyzed by RNA-seq and all six carotenoid binding candidate genes sequenced were studied by real- time PCR. STAR4, GSTA2, Scarbl, and APOD in feather follicles showed different expressions in red breast and orange nape feathers compared with that of iridescent mantle feathers. Further comparison of golden pheasant yellow rump and Lady Amherst＇s pheasant （Chrysolophus amherstiae） white nape feathers suggested that GSTA2 and APOD played a potential role in carotenoid-based coloration in golden pheasant.
基金supported by the National Transgenic Project of China (2016ZX08010001-002)the National Natural Science Foundation of China (81471001)+1 种基金the Inner Mongolia Science and Technology Program, China (201502073)the National 863 Prgram of China (2009AA10Z111)
文摘This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat（CRISPR）/Cas9-mediated gene knock-ins with zinc finger nucleases（ZFNs） and transcription activator-like effector nucleases（TALENs） in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin（MSTN） gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in theGFP-PGK-Neo R plasmid background, including a 5′ and 3′ homologous arm flanking the genes humanized Fat-1（h Fat-1） or enhanced green fluorescent protein（eGFP）. Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and thehFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418（Geneticin） selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP andhFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP andhFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, thehFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knockin efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant（P〈0.01）. In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP andhFat-1 gene knock-ins were 32.35 and 26.47%, respectively. Theefficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant（P〈0.01）. This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.
