The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
The specificity of the double-stranded RNA(dsRNA) used in the RNA interference(RNAi) technique is crucial for the success of sequence-specific gene silencing. Currently, RNAi-mediated insect control is a trending rese...The specificity of the double-stranded RNA(dsRNA) used in the RNA interference(RNAi) technique is crucial for the success of sequence-specific gene silencing. Currently, RNAi-mediated insect control is a trending research topic.However, the off-target effects of the dsRNA in RNAi are a major concern. In this study, the ds Hvβ’COPI(coat protein complex I, β’ subunit)-treated and untreated transcriptomes of the 28-spotted potato lady beetle(Henosepilachna vigintioctopunctata) were compared to understand its off-target gene silencing effects. The RNA-seq results revealed that 63 and 44 differentially expressed genes(DEGs) were upregulated and downregulated, respectively, in the ds Hvβ’COPI treated group as compared with the control. Validation of the differential expressions of some selected DEGs via reverse transcription-quantitative PCR(RT-qPCR) analysis confirmed the reliability of the transcriptome analysis results. Further downstream analysis revealed that there were no genes homologous with Hvβ’COPI in H. vigintioctopunctata. Additionally,no genes with a >11 bp continuous match with ds Hvβ’COPI were found in the H. vigintioctopunctata transcriptome. Six genes(Hvcitron, Hvhelicase, Hvtransposase, Hvserine, Hvdynein, and Hv E3 ubiquitin) were selected to examine the offtarget activity of ds Hvβ’COPI based on their potential involvement in various H. vigintioctopunctata metabolic pathways.The severity of silencing these six off-target genes was evaluated by employing RNAi. The RNAi results confirmed the downregulation of the expression of all six genes, although there was no significant lethality. The findings of this study will be helpful in the risk analysis of future RNAi-mediated pest control experiments.展开更多
A recent breakthrough in agricultural biotechnology is the introduction of RNAi-mediated strategies in pest control.However, the off-target effects of RNAi pest control are still not fully understood. Here, we studied...A recent breakthrough in agricultural biotechnology is the introduction of RNAi-mediated strategies in pest control.However, the off-target effects of RNAi pest control are still not fully understood. Here, we studied the off-target effects of two insecticidal siRNAs in both target and non-target insects. The results revealed that off-target effects of insecticidal siRNAs occur widely in both target and non-target insects. We classified the expression-changed genes according to their homology to the siRNA-targeted gene, related KEGG pathways with the siRNA-targeted gene and continuous matches with siRNAs. Surprisingly, the unintended significant changes in gene expression levels did not strictly match with the number of contiguous nucleotides in the siRNAs. As expected, the expression of small portions of the homologous and KEGG-related genes were significantly changed. We calculated the Shannon entropy of the transcriptome profile of the insects after injecting them with insecticidal siRNAs. Though hundreds of genes were affected in their expression levels post siRNAtreatment, the Shannon entropy of the transcriptome remained unchanged, suggesting that the transcriptome expression was balanced. Our results provide evidence that siRNAs cross-reacted with individual genes in non-target species, but did not have significant effects on the integrity of the transcriptome profiles in either target or non-target species on a genomic scale. The metric we proposed can be used to estimate the off-target effects of insecticidal siRNAs, which might be useful for evaluating the safety of RNAi in pest control.展开更多
The imperative aspect of the CRISPR/Cas9 system is a short stretch of 20 nucleotides of gRNA that control the overall specificity.Due to the small size,the chance of its multiple occurrences in the genome increases;how...The imperative aspect of the CRISPR/Cas9 system is a short stretch of 20 nucleotides of gRNA that control the overall specificity.Due to the small size,the chance of its multiple occurrences in the genome increases;however,a few mismatches are tolerated by the Cas9 endonuclease activity.An accurate and careful in silico-based off-target prediction while target selection is preferred to address the issue.These predictions are based on a comprehensive set of selectable parameters.Therefore,we investigated the possible off-target prediction and their screening in StERF3 gene-edited potato plants while developing StERF3-loss-of-function mutants using CRISPR/Cas9 approach.The 201 off-targets for the selected targets of the StERF3 gene were predicted,and 79 werefiltered as potential off-targets.Of these 79,twenty-five off-targets showed scores with defined cut-off values<0.5 and were analyzed in Sterf3-edited potato plants compared to wild-type plants.No off-targeting was found to have occurred in edited plants.展开更多
Ensuring drug safety in the early stages of drug development is crucial to avoid costly failures in subsequent phases.However,the economic burden associated with detecting drug off-targets and potential side effects t...Ensuring drug safety in the early stages of drug development is crucial to avoid costly failures in subsequent phases.However,the economic burden associated with detecting drug off-targets and potential side effects through in vitro safety screening and animal testing is substantial.Drug off-target interactions,along with the adverse drug reactions they induce,are significant factors affecting drug safety.To assess the liability of candidate drugs,we developed an artificial intelligence model for the precise prediction of compound off-target interactions,leveraging multi-task graph neural networks.The outcomes of off-target predictions can serve as representations for compounds,enabling the differentiation of drugs under various ATC codes and the classification of compound toxicity.Furthermore,the predicted off-target profiles are employed in adverse drug reaction(ADR)enrichment analysis,facilitating the inference of potential ADRs for a drug.Using the withdrawn drug Pergolide as an example,we elucidate the mechanisms underlying ADRs at the target level,contributing to the exploration of the potential clinical relevance of newly predicted off-target interactions.Overall,our work facilitates the early assessment of compound safety/toxicity based on off-target identification,deduces potential ADRs of drugs,and ultimately promotes the secure development of drugs.展开更多
Bacille Calmette-Guérin(BCG)vaccine is designed to provide protection against tuberculosis(TB).However,numerous epidemiological,clinical,and immunological studies have shown that BCG vaccination affects neonatal ...Bacille Calmette-Guérin(BCG)vaccine is designed to provide protection against tuberculosis(TB).However,numerous epidemiological,clinical,and immunological studies have shown that BCG vaccination affects neonatal and infant mortality,which may be related to the reduction of TB-unrelated infections and diseases by BCG vaccine.We aimed to discuss the off-target effects of BCG vaccine on un-TB infections and diseases,as well as the potential mechanism and influencing factors.Literature was retrieved mainly from PubMed using medical subject headings"BCG,variations,and non-specific,heterologous or off-target".Studies have showed that BCG vaccination can prevent various heterologous infections,including respiratory tract infections,leprosy,and malaria,treat viral infections including human papillomavirus and herpes simplex virus infection as immunotherapy,and improve the immune responses as vaccine adjuvant.Besides,BCG vaccine can reduce the recurrence rate of non-muscle-invasive bladder cancer,and may provide protection against autoimmune diseases.These off-target effects of BCG vaccine are thought to be achieved by modulating heterologous lymphocyte responses or inducing trained immunity,which were found to be sex-differentiated and affected by the BCG vaccine strains,sequence or time of vaccination.展开更多
CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of ...CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of CRISPR systems.The on-target efficiency has been improved in several advanced versions of CRISPR systems,whereas the off-target detection still remains a key challenge.Here,we outline the different versions of CRISPR systems and off-target detection strategies,discuss the merits and limitations of off-target detection methods,and provide potential implications for further gene editing research.展开更多
As versatile and robust genome editing tools,clustered regularly interspaced short palindromic repeats(CRISPR)technologies have been broadly used in basic research,biotechnology,and therapeutic development.Off-target ...As versatile and robust genome editing tools,clustered regularly interspaced short palindromic repeats(CRISPR)technologies have been broadly used in basic research,biotechnology,and therapeutic development.Off-target mutagenesis by CRISPR systems has been demonstrated,and various methods have been developed to markedly increase their specificity.In this review,we highlight the efforts of producing and modifying guide RNA(gRNA)to minimize off-target activities,including sequence and structure design,tuning expression and chemical modification.The modalities of gRNA engineering can be applied across CRISPR systems.In conjunction with CRISPR protein effectors,the engineered gRNA enables efficient and precise genome editing.展开更多
Targeted genome modifications with the Cas9/gRNA system derived from the clustered regularly interspaced short palin- dromic repeat/CRISPR-associated （CRISPR/Cas） system have been successfully used in cultured human...Targeted genome modifications with the Cas9/gRNA system derived from the clustered regularly interspaced short palin- dromic repeat/CRISPR-associated （CRISPR/Cas） system have been successfully used in cultured human cells as well as in most model organisms, including zebrafish （Danio rerio）, mouse, and fruit fly （Chang et al., 2013; Cong et al., 2013; Gratz et al., 2013; Hwang et al., 2013; Jao et al., 2013; Shen et al., 2013; Wei et al., 2013）. Its application in zebrafish is particu- larly attractive due to the ease of handling this organism and the simple application of this method by direct injection of Cas9/ gRNA. However, the information about its specificity in this organism is very limited and needs further evaluation. In addition, it is conceivable that a Cas9 mRNA optimized for zebrafish codon preference could enhance its activity.展开更多
Site-directed RNA editing(SDRE)is invaluable to basic research and clinical applications and has emerged as a new frontier in genome editing.The past few years have witnessed a surge of interest in SDRE,with SDRE tool...Site-directed RNA editing(SDRE)is invaluable to basic research and clinical applications and has emerged as a new frontier in genome editing.The past few years have witnessed a surge of interest in SDRE,with SDRE tools emerging at a breathtaking pace.However,off-target effects of SDRE remain a tough problem,which constitutes a major hurdle to their clinical applications.Here we discuss the diverse strategies for combating off-target editing,drawing lessons from the published studies as well as our ongoing research.Overall,SDRE is still at its infancy,with significant challenges and exciting opportunities ahead.展开更多
Polypharmacology,which focuses on designing drugs to target multiple receptors,has emerged as a new paradigm in drug discovery.To rationally design multi-target drugs,it is fundamental to understand protein-ligand int...Polypharmacology,which focuses on designing drugs to target multiple receptors,has emerged as a new paradigm in drug discovery.To rationally design multi-target drugs,it is fundamental to understand protein-ligand interactions on a proteome scale.We have developed a Proteome-wide Off-target Pipeline （POP） that integrates ligand binding site analysis,protein-ligand docking,the statistical analysis of docking scores,and electrostatic potential calculations.The utility of POP is demonstrated by a case study,in which the molecular mechanism of anti-cancer effect of Nelfinavir is hypothesized.By combining structural proteome-wide off-target identification and systems biology,it is possible for us to correlate drug perturbations with clinical outcomes.展开更多
RNA base editing is a promising tool in precise molecular therapy. Currently, there are two widely used RNA base editors, REPAIRand RESCUE. REPAIR only facilitates A-to-I conversions, while RESCUE performs both A-to-I...RNA base editing is a promising tool in precise molecular therapy. Currently, there are two widely used RNA base editors, REPAIRand RESCUE. REPAIR only facilitates A-to-I conversions, while RESCUE performs both A-to-I and C-to-U conversions. Thus, RESCUEcan generate twice the number of mutations compared to REPAIR. However, transcription-wide impact due to RESCUE-induced offtarget single-nucleotide variants (SNVs) is not fully appreciated. Therefore, to determine the off-target effects of RESCUE-mediatedediting, we employed transcription-wide sequencing on cells edited by RESCUE. The SNVs showed different off-target effects onmRNA, circRNA, lncRNA, and miRNA expression patterns and their interacting networks. Our results illustrate the transcriptionwide impact of RESCUE-induced off-target SNVs and highlight the need for careful characterization of the off-target impact by thisediting platform.展开更多
DNA is the blueprint of life,instructing the growth,development,and reproduction of an organism.Genome sequencing uncovers the codes of life,whereas genome editing could rewrite the codes,thus then leads to revolution...DNA is the blueprint of life,instructing the growth,development,and reproduction of an organism.Genome sequencing uncovers the codes of life,whereas genome editing could rewrite the codes,thus then leads to revolutionary advances in all aspects of life sciences,such as uncovering regulatory network of life,increasing the production of crops,producing new breeds of livestock,and curing genetic disorders(Liu,2017).展开更多
Revolutionary in scope and application, the CRISPR Cas9 endonuclease system can be guided by 20-nt single guide RNA （sgRNA） to any complementary loci on the double- stranded DNA. Once the target site is located, Cas...Revolutionary in scope and application, the CRISPR Cas9 endonuclease system can be guided by 20-nt single guide RNA （sgRNA） to any complementary loci on the double- stranded DNA. Once the target site is located, Cas9 can then cleave the DNA and introduce mutations. Despite the power of this system, sgRNA is highly susceptible to off-target homologous attachment and can consequently cause Cas9 to cleave DNA at off- target sites. In order to better understand this flaw in the system, the human genome and Streptococcus pyogenes Cas9 （SpCas9） were used in a mathematical and computational study to analyze the probabilities of potential sgRNA off-target homologies. It has been concluded that off-target sites are nearly unavoidable for large-size genomes, such as the human genome. Backed by mathematical analysis, a viable solution is the double-nicking method which has the promise for genome editing specificity. Also applied in this study was a computational algorithm for off-target homology search that was implemented in Java to confirm the mathematical analysis.展开更多
Gene therapy and antisense oligonucleotides (ASOs) are promising approaches to treating rare diseases by targeting specific genes. However, ASOs can have off-target effects that need careful consideration during devel...Gene therapy and antisense oligonucleotides (ASOs) are promising approaches to treating rare diseases by targeting specific genes. However, ASOs can have off-target effects that need careful consideration during development. Researchers can add moieties like peptide nucleic acid or methoxyethyl-modified ribose sugars to enhance specificity and reduce toxicity. Current research suggests that challenges such as nonspecific action, interference at various stages, adverse reactions, and nuclease degradation may soon be manageable with advanced technologies. ASOs show particular promise in treating rare conditions like Duchenne Muscular Dystrophy (DMD) and Timothy syndrome. Stereopure ASOs with repeated left-right patterns offer increased potency and half-life due to their resistance to nuclease activity and improved cellular uptake. This review explores how technological advancements can enhance the use of ASOs to manage various rare disease conditions effectively. Despite challenges in development and application, ASO therapy holds the potential to become a viable treatment option for a wide range of rare diseases. Advances in technology offer the possibility of increasing specificity and reducing toxicity, making ASO therapy a more effective and safe treatment option for patients with rare diseases.展开更多
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金supported by the National Natural Science Foundation of China(31972269 and 32172500)the National Key R&D Program of China(2017YFD0200900)。
文摘The specificity of the double-stranded RNA(dsRNA) used in the RNA interference(RNAi) technique is crucial for the success of sequence-specific gene silencing. Currently, RNAi-mediated insect control is a trending research topic.However, the off-target effects of the dsRNA in RNAi are a major concern. In this study, the ds Hvβ’COPI(coat protein complex I, β’ subunit)-treated and untreated transcriptomes of the 28-spotted potato lady beetle(Henosepilachna vigintioctopunctata) were compared to understand its off-target gene silencing effects. The RNA-seq results revealed that 63 and 44 differentially expressed genes(DEGs) were upregulated and downregulated, respectively, in the ds Hvβ’COPI treated group as compared with the control. Validation of the differential expressions of some selected DEGs via reverse transcription-quantitative PCR(RT-qPCR) analysis confirmed the reliability of the transcriptome analysis results. Further downstream analysis revealed that there were no genes homologous with Hvβ’COPI in H. vigintioctopunctata. Additionally,no genes with a >11 bp continuous match with ds Hvβ’COPI were found in the H. vigintioctopunctata transcriptome. Six genes(Hvcitron, Hvhelicase, Hvtransposase, Hvserine, Hvdynein, and Hv E3 ubiquitin) were selected to examine the offtarget activity of ds Hvβ’COPI based on their potential involvement in various H. vigintioctopunctata metabolic pathways.The severity of silencing these six off-target genes was evaluated by employing RNAi. The RNAi results confirmed the downregulation of the expression of all six genes, although there was no significant lethality. The findings of this study will be helpful in the risk analysis of future RNAi-mediated pest control experiments.
基金funded by grants from the National Science and Technology Major Project of China(2016ZX08011002)。
文摘A recent breakthrough in agricultural biotechnology is the introduction of RNAi-mediated strategies in pest control.However, the off-target effects of RNAi pest control are still not fully understood. Here, we studied the off-target effects of two insecticidal siRNAs in both target and non-target insects. The results revealed that off-target effects of insecticidal siRNAs occur widely in both target and non-target insects. We classified the expression-changed genes according to their homology to the siRNA-targeted gene, related KEGG pathways with the siRNA-targeted gene and continuous matches with siRNAs. Surprisingly, the unintended significant changes in gene expression levels did not strictly match with the number of contiguous nucleotides in the siRNAs. As expected, the expression of small portions of the homologous and KEGG-related genes were significantly changed. We calculated the Shannon entropy of the transcriptome profile of the insects after injecting them with insecticidal siRNAs. Though hundreds of genes were affected in their expression levels post siRNAtreatment, the Shannon entropy of the transcriptome remained unchanged, suggesting that the transcriptome expression was balanced. Our results provide evidence that siRNAs cross-reacted with individual genes in non-target species, but did not have significant effects on the integrity of the transcriptome profiles in either target or non-target species on a genomic scale. The metric we proposed can be used to estimate the off-target effects of insecticidal siRNAs, which might be useful for evaluating the safety of RNAi in pest control.
文摘The imperative aspect of the CRISPR/Cas9 system is a short stretch of 20 nucleotides of gRNA that control the overall specificity.Due to the small size,the chance of its multiple occurrences in the genome increases;however,a few mismatches are tolerated by the Cas9 endonuclease activity.An accurate and careful in silico-based off-target prediction while target selection is preferred to address the issue.These predictions are based on a comprehensive set of selectable parameters.Therefore,we investigated the possible off-target prediction and their screening in StERF3 gene-edited potato plants while developing StERF3-loss-of-function mutants using CRISPR/Cas9 approach.The 201 off-targets for the selected targets of the StERF3 gene were predicted,and 79 werefiltered as potential off-targets.Of these 79,twenty-five off-targets showed scores with defined cut-off values<0.5 and were analyzed in Sterf3-edited potato plants compared to wild-type plants.No off-targeting was found to have occurred in edited plants.
基金supported by National Key Research and Development Program of China(2022YFC3400504 to Mingyue Zheng)National Natural Science Foundation of China(T2225002 and 82273855 to Mingyue Zheng,82204278 to Xutong Li)+2 种基金Lingang Laboratory(LG202102-01-02 to Mingyue Zheng)SIMMSHUTCM Traditional Chinese Medicine Innovation Joint Research Program(E2G805H to Mingyue Zheng)Shanghai Municipal Science and Technology Major Project.
文摘Ensuring drug safety in the early stages of drug development is crucial to avoid costly failures in subsequent phases.However,the economic burden associated with detecting drug off-targets and potential side effects through in vitro safety screening and animal testing is substantial.Drug off-target interactions,along with the adverse drug reactions they induce,are significant factors affecting drug safety.To assess the liability of candidate drugs,we developed an artificial intelligence model for the precise prediction of compound off-target interactions,leveraging multi-task graph neural networks.The outcomes of off-target predictions can serve as representations for compounds,enabling the differentiation of drugs under various ATC codes and the classification of compound toxicity.Furthermore,the predicted off-target profiles are employed in adverse drug reaction(ADR)enrichment analysis,facilitating the inference of potential ADRs for a drug.Using the withdrawn drug Pergolide as an example,we elucidate the mechanisms underlying ADRs at the target level,contributing to the exploration of the potential clinical relevance of newly predicted off-target interactions.Overall,our work facilitates the early assessment of compound safety/toxicity based on off-target identification,deduces potential ADRs of drugs,and ultimately promotes the secure development of drugs.
文摘Bacille Calmette-Guérin(BCG)vaccine is designed to provide protection against tuberculosis(TB).However,numerous epidemiological,clinical,and immunological studies have shown that BCG vaccination affects neonatal and infant mortality,which may be related to the reduction of TB-unrelated infections and diseases by BCG vaccine.We aimed to discuss the off-target effects of BCG vaccine on un-TB infections and diseases,as well as the potential mechanism and influencing factors.Literature was retrieved mainly from PubMed using medical subject headings"BCG,variations,and non-specific,heterologous or off-target".Studies have showed that BCG vaccination can prevent various heterologous infections,including respiratory tract infections,leprosy,and malaria,treat viral infections including human papillomavirus and herpes simplex virus infection as immunotherapy,and improve the immune responses as vaccine adjuvant.Besides,BCG vaccine can reduce the recurrence rate of non-muscle-invasive bladder cancer,and may provide protection against autoimmune diseases.These off-target effects of BCG vaccine are thought to be achieved by modulating heterologous lymphocyte responses or inducing trained immunity,which were found to be sex-differentiated and affected by the BCG vaccine strains,sequence or time of vaccination.
基金supported by the grants 81771230(W.C.),31922048(E.Z.)and 31522037(H.Y.)from the National Natural Science Foundation of China.
文摘CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of CRISPR systems.The on-target efficiency has been improved in several advanced versions of CRISPR systems,whereas the off-target detection still remains a key challenge.Here,we outline the different versions of CRISPR systems and off-target detection strategies,discuss the merits and limitations of off-target detection methods,and provide potential implications for further gene editing research.
基金supported by the National Key Research and Development Program of China(2018YFA0801401 and 2019YFA0802801)the National Natural Science Foundation of China 31871345+1 种基金the Young Thousand Talented Program from Wuhan Universitythe startup funding from Wuhan University to H.Y.
文摘As versatile and robust genome editing tools,clustered regularly interspaced short palindromic repeats(CRISPR)technologies have been broadly used in basic research,biotechnology,and therapeutic development.Off-target mutagenesis by CRISPR systems has been demonstrated,and various methods have been developed to markedly increase their specificity.In this review,we highlight the efforts of producing and modifying guide RNA(gRNA)to minimize off-target activities,including sequence and structure design,tuning expression and chemical modification.The modalities of gRNA engineering can be applied across CRISPR systems.In conjunction with CRISPR protein effectors,the engineered gRNA enables efficient and precise genome editing.
基金partially supported by the National Natural Science Foundation of China (No. 31110103904)the National Program on Key Basic Research Project (973 Program) of the Ministry of Science and Technology of China (Nos. 2011CBA01000 and 2012CB945101)
文摘Targeted genome modifications with the Cas9/gRNA system derived from the clustered regularly interspaced short palin- dromic repeat/CRISPR-associated （CRISPR/Cas） system have been successfully used in cultured human cells as well as in most model organisms, including zebrafish （Danio rerio）, mouse, and fruit fly （Chang et al., 2013; Cong et al., 2013; Gratz et al., 2013; Hwang et al., 2013; Jao et al., 2013; Shen et al., 2013; Wei et al., 2013）. Its application in zebrafish is particu- larly attractive due to the ease of handling this organism and the simple application of this method by direct injection of Cas9/ gRNA. However, the information about its specificity in this organism is very limited and needs further evaluation. In addition, it is conceivable that a Cas9 mRNA optimized for zebrafish codon preference could enhance its activity.
基金supported by the start-up package of the ShanghaiTech University.
文摘Site-directed RNA editing(SDRE)is invaluable to basic research and clinical applications and has emerged as a new frontier in genome editing.The past few years have witnessed a surge of interest in SDRE,with SDRE tools emerging at a breathtaking pace.However,off-target effects of SDRE remain a tough problem,which constitutes a major hurdle to their clinical applications.Here we discuss the diverse strategies for combating off-target editing,drawing lessons from the published studies as well as our ongoing research.Overall,SDRE is still at its infancy,with significant challenges and exciting opportunities ahead.
基金supported by the National Institutes of Health GM078596High Performance Computing Center at The City University of New York
文摘Polypharmacology,which focuses on designing drugs to target multiple receptors,has emerged as a new paradigm in drug discovery.To rationally design multi-target drugs,it is fundamental to understand protein-ligand interactions on a proteome scale.We have developed a Proteome-wide Off-target Pipeline （POP） that integrates ligand binding site analysis,protein-ligand docking,the statistical analysis of docking scores,and electrostatic potential calculations.The utility of POP is demonstrated by a case study,in which the molecular mechanism of anti-cancer effect of Nelfinavir is hypothesized.By combining structural proteome-wide off-target identification and systems biology,it is possible for us to correlate drug perturbations with clinical outcomes.
基金supported by grants from the Ministry of Agriculture of China(2016ZX08009003-006 and 2011ZX08006-001)the National Key Laboratory Open Fund Project(2020SKLAB6-24)+1 种基金the ZJU-Hangzhou Global Scientific and Technological Innovation Center,Zhejiang University(02020200-K02013008)the National Natural Science Foundation of China(32071347).
文摘RNA base editing is a promising tool in precise molecular therapy. Currently, there are two widely used RNA base editors, REPAIRand RESCUE. REPAIR only facilitates A-to-I conversions, while RESCUE performs both A-to-I and C-to-U conversions. Thus, RESCUEcan generate twice the number of mutations compared to REPAIR. However, transcription-wide impact due to RESCUE-induced offtarget single-nucleotide variants (SNVs) is not fully appreciated. Therefore, to determine the off-target effects of RESCUE-mediatedediting, we employed transcription-wide sequencing on cells edited by RESCUE. The SNVs showed different off-target effects onmRNA, circRNA, lncRNA, and miRNA expression patterns and their interacting networks. Our results illustrate the transcriptionwide impact of RESCUE-induced off-target SNVs and highlight the need for careful characterization of the off-target impact by thisediting platform.
基金supported by the National Key R&D Program of China(2017YFC1001901)the National Natural Science Foundation(31971365 and 31601196)the Guangzhou Science and Technology Project(201803010020 and 201707010085).
文摘DNA is the blueprint of life,instructing the growth,development,and reproduction of an organism.Genome sequencing uncovers the codes of life,whereas genome editing could rewrite the codes,thus then leads to revolutionary advances in all aspects of life sciences,such as uncovering regulatory network of life,increasing the production of crops,producing new breeds of livestock,and curing genetic disorders(Liu,2017).
文摘Revolutionary in scope and application, the CRISPR Cas9 endonuclease system can be guided by 20-nt single guide RNA （sgRNA） to any complementary loci on the double- stranded DNA. Once the target site is located, Cas9 can then cleave the DNA and introduce mutations. Despite the power of this system, sgRNA is highly susceptible to off-target homologous attachment and can consequently cause Cas9 to cleave DNA at off- target sites. In order to better understand this flaw in the system, the human genome and Streptococcus pyogenes Cas9 （SpCas9） were used in a mathematical and computational study to analyze the probabilities of potential sgRNA off-target homologies. It has been concluded that off-target sites are nearly unavoidable for large-size genomes, such as the human genome. Backed by mathematical analysis, a viable solution is the double-nicking method which has the promise for genome editing specificity. Also applied in this study was a computational algorithm for off-target homology search that was implemented in Java to confirm the mathematical analysis.
文摘Gene therapy and antisense oligonucleotides (ASOs) are promising approaches to treating rare diseases by targeting specific genes. However, ASOs can have off-target effects that need careful consideration during development. Researchers can add moieties like peptide nucleic acid or methoxyethyl-modified ribose sugars to enhance specificity and reduce toxicity. Current research suggests that challenges such as nonspecific action, interference at various stages, adverse reactions, and nuclease degradation may soon be manageable with advanced technologies. ASOs show particular promise in treating rare conditions like Duchenne Muscular Dystrophy (DMD) and Timothy syndrome. Stereopure ASOs with repeated left-right patterns offer increased potency and half-life due to their resistance to nuclease activity and improved cellular uptake. This review explores how technological advancements can enhance the use of ASOs to manage various rare disease conditions effectively. Despite challenges in development and application, ASO therapy holds the potential to become a viable treatment option for a wide range of rare diseases. Advances in technology offer the possibility of increasing specificity and reducing toxicity, making ASO therapy a more effective and safe treatment option for patients with rare diseases.
